SKINIPEDIA - Skin Encyclopedia: Vitiligo and Genetic Risk

Twitter Delicious Facebook Bookmark and Share
SEARCH SKIN ENCYCLOPEDIA:



Genetic Variation of Promoter Sequence Modulates XBP1 Expression and Genetic Risk for Vitiligo

Yunqing Ren1,2, Sen Yang1,2, Shengxin Xu1,2, Min Gao1,2, Wei Huang3, Tianwen Gao4, Qiaoyun Fang1,2, Cheng Quan1,2, Chi Zhang1,2, Liangdan Sun1,2, Yanhua Liang1,2, Jianwen Han1,2, Zhimin Wang3, Fengyu Zhang1,2, Youwen Zhou1,2,5, Jianjun Liu1,2,6*, Xuejun Zhang1,2*

1 Institute of Dermatology and Department of Dermatology at No. 1 Hospital, Anhui Medical University, Hefei, Anhui, China, 2 The Key Laboratory of Gene Resource Utilization for Severe Diseases, Ministry of Education and Anhui Province, Hefei, Anhui, China, 3 Chinese National Human Genome Center at Shanghai, Shanghai, China, 4 Department of Dermatology of Xijing Hospital, Fourth Military Medical University, Xi'an, Shanxi, China, 5 Department of Dermatology and Skin Science, University of British Columbia, Vancouver, British Columbia, Canada, 6 Human Genetics, Genome Institute of Singapore, Singapore

SOURCE: http://www.plosgenetics.org/article/info%3Adoi%2F10.1371%2Fjournal.pgen.1000523


Real-Time Quantitative RT–PCR Analysis

Human skin biopsies (3 mm) were collected in the Department of Dermatology at First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, China with informed consent. Paired biopsies were obtained from each of 38 patients: one from the lesional skin (at least 2 cm from the lesional boarders), the other from the symmetrical normal skin (also more than 2 cm from the lesional boarders). Total RNA was isolated by using RNeasy Mini kit (Qiagen) with treatment of DNase, according to the manufacturer's instructions. We carried out reverse transcription according to the Superscript protocol (TaKaRa). Real-time PCR was performed using the iCycler (Bio-Rad). Reactions were performed in a 10-µl volume including diluted cDNA samples, primers, and SYBR Green I Mastermix (TaKaRa). For real-time PCR analysis, XBP1 was amplified with forward primer 5′-TGAGCTGGAACAGC AAGTGGT-3′ and reverse primer 5′- CCCAAGCGCTGTCTTAACTCC-3′. 18 s RNA served as an endogenous control and was amplified with forward primer 5′- GTAACCCGTTGAACCCCATT -3′ and reverse prime 5′- CCATCCAATCGGTAGTAGCG -3′. Dissociation curve analyses were performed to confirm specificity of the SYBR Green signals in each experiment. Real-time PCR data were collected using iCycler software (version 3.1, Bio-Rad). Both 18 s RNA and XBP1 were tested in triplicate for each sample. The measurement (Ct value) of XBP1 expression was normalized by using 18 s' measurement (Ct value). For the overall comparison of XBP1 expression between the lesional and non-lesional skins, all the normalized measurements (ΔCt) were standardized so that the average of the ΔCts of non-lensional skin samples was equal to 1. For the comparison of XBP expression between the paired lesional and non-lesional samples from same patients, the normalized measurements (ΔCt) were used to calculate the difference (ΔΔCt) between the lesional and non-lesional skin samples from the same patient. The fold change in the expression level was calculated by using the formula of 2ΔΔCt.

Immunohistochemistry Analysis

Lesional and non-lesional skin samples were collected (as the same as above) from another 37 patients, and fixed in formalin. Fixed tissues were embedded routinely in paraffin, serially sectioned at 5 µm, and placed on poly-L-lysine coated slides for immunohistochemistry with an ABC Staining kit (Santa Cruz Biotechnology, CA, USA) in accordance with the manufacturer's instructions. The sections were de-paraffinized, rehydrated and reacted overnight at 4°C with the primary Rabbit anti-human XBP1 polyclonal antibody (ab37152, abcam, CA, USA) at a dilution of 1:200. The biotin-labeled secondary antibody (sc-2491, Santa Cruz Biotechnology, CA, USA) was added at a dilution of 1:100. Diaminobenzidine (DAB) was used for staining development and the sections were counterstained with haematoxylin. The staining intensity and the percentage of positive cells were evaluated using regular light microscopy by two observers who were blind to the clinical data (the lesion or the normal) independently.

Statistical Analysis

We performed Armitage Trend test to assess genotype-phenotyoe association as well as allelic association analysis using the Plink 1.02 software [41]. Association analysis of the combined samples was performed using Cochran-Mantel-Hanezel stratification analysis [42]. Hardy-Weinberg proportion was tested in control samples to ensure genotyping quality. The TDT analysis was performed to test association in case-parent triad data using the Haploview version 3.2 [43]. The comparison between the clinical subgroups was performed by testing the association of rs2269577 with clinical sub-phenotypes using genotype-based trend test. Interaction analysis was performed by comparing the logistic regression model of only main effect against the model of both the main and interactive effects. Chi-square test was used for estimating the significance of the statistics of the log-likelihood ratio test. To examine the pattern of the interaction, we performed the analysis of XBP1 gene stratified by HLA positive and negative.

Student's t test was used to examine the differences in luciferase reporter gene expression. Differences in mRNA level of XBP1 between lesional and normal skins (in all the patients as well as within different genotype groups) were tested for significance with the nonparametric Wilcoxon signed-rank test. Correlation between mRNA levels of XBP1 and genotype (GG vs GC+CC) was analyzed using Mann-Whitney U test. Differences in protein level between lesional and normal skins within different genotype groups were tested using Paired Samples T Test. All the statistical analyses were done in SPSS 10.0.

Supporting Information Top

Figure S1.

Genomic structure of the XBP1 gene with the location of 8 SNPs subjected to genetic association analysis. The gray bars (underneath the genomic structure) indicate the genomic regions that were amplified for sequencing analysis.

(1.34 MB TIF)

Table S1.

A list of all the variants identified by the initial sequencing analysis of XBP1.

(0.07 MB DOC)

Table S2.

Primers used for the sequencing analysis of the exons, exon-intron boundaries, and some promoter sequences of XBP1.

(0.03 MB DOC)

Table S3.

Frequencies of HLA-DR alleles in vitiligo patients compared with control group.

(0.03 MB DOC)

Acknowledgments Top

We are most grateful to all the individuals and families who participated in this study and the collaborating clinics and physicians for referring individuals to the study. We also would like to thank Qiang Wu, Linjie Zhang, Yan Yang, Jinping Gui, Chunjun Yang, Hui Chen, Xianyong Yin, Houfeng Zheng, Xianbo Zuo, and Fusheng Zhou for their assistance in sample collection, cell culture, and data analysis.

Author Contributions Top

Conceived and designed the experiments: JL XZ. Performed the experiments: YR SX QF CQ YL. Analyzed the data: YR MG ZW JL. Contributed reagents/materials/analysis tools: YR SX MG TG CZ LS YL JH. Wrote the paper: YR JL. Participated with aspects of study design and interpretation of the data: SY WH FZ YZ.

References Top

  1. Fain PR, Gowan K, LaBerge GS, Alkhateeb A, Stetler GL, et al. (2003) A genomewide screen for generalized vitiligo: confirmation of AIS1 on chromosome 1p31 and evidence for additional susceptibility loci. Am J Hum Genet 72: 1560–1564. Find this article online
  2. Zhang XJ, Liu JB, Gui JP, Li M, Xiong QG, et al. (2004) Characteristics of genetic epidemiology and genetic models for vitiligo. J Am Acad Dermatol 51: 383–390. Find this article online
  3. Yang S, Wang JY, Gao M, Liu HS, Sun LD, et al. (2005) Association of HLA-DQA1 and DQB1 genes with vitiligo in Chinese Hans. Int J Dermatol 44: 1022–1027. Find this article online
  4. Nath SK, Kelly JA, Namjou B, Lam T, Bruner GR, et al. (2001) Evidence for a susceptibility gene, SLEV1, on chromosome 17p13 in families with vitiligo-related systemic lupus erythematosus. Am J Hum Genet 69: 1401–1406. Find this article online
  5. Alkhateeb A, Stetler GL, Old W, Talbert J, Uhlhorn C, et al. (2002) Mapping of an autoimmunity susceptibility locus (AIS1) to chromosome 1p31.3-p32.2. Hum Mol Genet 11: 661–667. Find this article online
  6. Spritz RA, Gowan K, Bennett DC, Fain PR (2004) Novel vitiligo susceptibility loci on chromosomes 7 (AIS2) and 8 (AIS3), confirmation of SLEV1 on chromosome 17, and their roles in an autoimmune diathesis. Am J Hum Genet 74: 188–191. Find this article online
  7. Chen JJ, Huang W, Gui JP, Yang S, Zhou FS, et al. (2005) A novel linkage to generalized vitiligo on 4q13-q21 identified in a genomewide linkage analysis of Chinese families. Am J Hum Genet 76: 1057–1065. Find this article online
  8. Liang Y, Yang S, Zhou Y, Gui J, Ren Y, et al. (2007) Evidence for two susceptibility loci on chromosomes 22q12 and 6p21-p22 in Chinese generalized vitiligo families. J Invest Dermatol 127: 2552–2557. Find this article online
  9. Spritz RA (2007) The genetics of generalized vitiligo and associated autoimmune diseases. Pigment Cell Res 20: 271–278. Find this article online
  10. Rezaei N, Gavalas NG, Weetman AP, Kemp EH (2007) Autoimmunity as an aetiological factor in vitiligo. J Eur Acad Dermatol Venereol 21: 865–876. Find this article online
  11. Tazi-Ahnini R, McDonagh AJ, Wengraf DA, Lovewell TR, Vasilopoulos Y, et al. (2008) The autoimmune regulator gene (AIRE) is strongly associated with vitiligo. Br J Dermatol 159: 591–596. Find this article online
  12. Alkhateeb A, Fain PR, Spritz RA (2005) Candidate functional promoter variant in the FOXD3 melanoblast developmental regulator gene in autosomal dominant vitiligo. J Invest Dermatol 125: 388–391. Find this article online
  13. LaBerge GS, Bennett DC, Fain PR, Spritz RA (2008) PTPN22 is genetically associated with risk of generalized vitiligo, but CTLA4 is not. J Invest Dermatol 128: 1757–1762. Find this article online
  14. Jin Y, Mailloux CM, Gowan K, Riccardi SL, LaBerge G, et al. (2007) NALP1 in vitiligo-associated multiple autoimmune disease. N Engl J Med 356: 1216–1225. Find this article online
  15. Liou HC, Boothby MR, Finn PW, Davidon R, Nabavi N, et al. (1990) A new member of the leucine zipper class of proteins that binds to the HLA DR alpha promoter. Science 247: 1581–1584. Find this article online
  16. Tastan HB, Akar A, Orkunoglu FE, Arca E, Inal A (2004) Association of HLA class I antigens and HLA class II alleles with vitiligo in a Turkish population. Pigment Cell Res 17: 181–184. Find this article online
  17. Zamani M, Spaepen M, Sghar SS, Huang C, Westerhof W, et al. (2001) Linkage and association of HLA class II genes with vitiligo in a Dutch population. Br J Dermatol 145: 90–94. Find this article online
  18. Fain PR, Babu SR, Bennett DC, Spritz RA (2006) HLA class II haplotype DRB1*04-DQB1*0301 contributes to risk of familial generalized vitiligo and early disease onset. Pigment Cell Res 19: 51–57. Find this article online
  19. Kakiuchi C, Iwamoto K, Ishiwata M, Bundo M, Kasahara T, et al. (2003) Impaired feedback regulation of XBP1 as a genetic risk factor for bipolar disorder. Nat Genet 35: 171–175. Find this article online
  20. Cichon S, Buervenich S, Kirov G, Akula N, Dimitrova A, et al. (2004) Lack of support for a genetic association of the XBP1 promoter polymorphism with bipolar disorder in probands of European origin. Nat Genet 36: 783–784; author reply 784–785. Find this article online
  21. Masui T, Hashimoto R, Kusumi I, Suzuki K, Tanaka T, et al. (2006) A possible association between the −116C/G single nucleotide polymorphism of the XBP1 gene and lithium prophylaxis in bipolar disorder. Int J Neuropsychopharmacol 9: 83–88. Find this article online
  22. Hou SJ, Yen FC, Cheng CY, Tsai SJ, Hong CJ (2004) X-box binding protein 1 (XBP1) C–116G polymorphisms in bipolar disorders and age of onset. Neurosci Lett 367: 232–234. Find this article online
  23. Kakiuchi C, Ishiwata M, Umekage T, Tochigi M, Kohda K, et al. (2004) Association of the XBP1-116C/G polymorphism with schizophrenia in the Japanese population. Psychiatry Clin Neurosci 58: 438–440. Find this article online
  24. Jonsson EG, Cichon S, Schumacher J, Abou Jamra R, Schulze TG, et al. (2006) Association study of a functional promoter polymorphism in the XBP1 gene and schizophrenia. Am J Med Genet B Neuropsychiatr Genet 141: 71–75. Find this article online
  25. Watanabe Y, Fukui N, Muratake T, Amagane H, Kaneko N, et al. (2006) Association study of a functional promoter polymorphism of the X-box binding protein 1 gene in Japanese patients with schizophrenia. Psychiatry Clin Neurosci 60: 633–635. Find this article online
  26. Chen W, Duan S, Zhou J, Sun Y, Zheng Y, et al. (2004) A case-control study provides evidence of association for a functional polymorphism -197C/G in XBP1 to schizophrenia and suggests a sex-dependent effect. Biochem Biophys Res Commun 319: 866–870. Find this article online
  27. Reimold AM, Etkin A, Clauss I, Perkins A, Friend DS, et al. (2000) An essential role in liver development for transcription factor XBP-1. Genes Dev 14: 152–157. Find this article online
  28. Clauss IM, Gravallese EM, Darling JM, Shapiro F, Glimcher MJ, et al. (1993) In situ hybridization studies suggest a role for the basic region-leucine zipper protein hXBP-1 in exocrine gland and skeletal development during mouse embryogenesis. Dev Dyn 197: 146–156. Find this article online
  29. Romero-Ramirez L, Cao H, Nelson D, Hammond E, Lee AH, et al. (2004) XBP1 is essential for survival under hypoxic conditions and is required for tumor growth. Cancer Res 64: 5943–5947. Find this article online
  30. Reimold AM, Iwakoshi NN, Manis J, Vallabhajosyula P, Szomolanyi-Tsuda E, et al. (2001) Plasma cell differentiation requires the transcription factor XBP-1. Nature 412: 300–307. Find this article online
  31. Lee AH, Chu GC, Iwakoshi NN, Glimcher LH (2005) XBP-1 is required for biogenesis of cellular secretory machinery of exocrine glands. Embo J 24: 4368–4380. Find this article online
  32. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K (2001) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107: 881–891. Find this article online
  33. Acosta-Alvear D, Zhou Y, Blais A, Tsikitis M, Lents NH, et al. (2007) XBP1 controls diverse cell type- and condition-specific transcriptional regulatory networks. Mol Cell 27: 53–66. Find this article online
  34. Shaffer AL, Shapiro-Shelef M, Iwakoshi NN, Lee AH, Qian SB, et al. (2004) XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases protein synthesis in plasma cell differentiation. Immunity 21: 81–93. Find this article online
  35. Lee AH, Iwakoshi NN, Glimcher LH (2003) XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol 23: 7448–7459. Find this article online
  36. Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, et al. (2004) Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306: 457–461. Find this article online
  37. Kaser A, Lee AH, Franke A, Glickman JN, Zeissig S, et al. (2008) XBP1 links ER stress to intestinal inflammation and confers genetic risk for human inflammatory bowel disease. Cell 134: 743–756. Find this article online
  38. Carrasco DR, Sukhdeo K, Protopopova M, Sinha R, Enos M, et al. (2007) The differentiation and stress response factor XBP-1 drives multiple myeloma pathogenesis. Cancer Cell 11: 349–360. Find this article online
  39. Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16: 1215. Find this article online
  40. Olerup O, Zetterquist H (1992) HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: an alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantation. Tissue Antigens 39: 225–235. Find this article online
  41. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, et al. (2007) PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 81: 559–575. Find this article online
  42. Mantel N, Haenszel W (1959) Statistical aspects of the analysis of data from retrospective studies of disease. J Natl Cancer Inst 22: 719–748. Find this article online
  43. Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21: 263–265. Find this article online

SKINIPEDIA your SKIN ENCYCLOPEDIA Home